Y-DNA Haplogroup G-M201 - Marres (2004) suggested the mutation took place only 9,500 years ago. The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). G-L13/S13 (Y-DNA) - geni family tree We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. PLoS One 2009; 4: e5792. Haplogroup - an overview | ScienceDirect Topics Haak W, Balanovsky O, Sanchez JJ et al. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Am J Hum Genet 2007; 80: 759768. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Kaniewski D, Van Campo E, Van Lerberghe K et al. The genetic variation in the R1a clade among the Ashkenazi - Nature The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. [2], In 2012, a paper by Siiri Rootsi et al. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Achilli A, Olivieri A, Pala M et al. Where did the haplogroup G-M201 originate? - Quora Semino O, Magri C, Benuzzi G et al. Haplogroup G1 is a primary subclade of haplogroup G . The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. The L141 mutation is found on the Y chromosome at 2948607. Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic . G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. Thank you for visiting nature.com. Princeton: Princeton University Press, 1994. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. Its chromosome location listed as 21653414. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. Haplogroup L2b1a is a branch on the maternal tree of human kind. Am J Hum Genet 2000; 67: 15261543. Mitochondrial haplogroup N is a "Macro-haplogroup", also called a "Superhaplogroup." All humans who left Africa descended from mtDNA haplogroup L3, and that ancient lineage soon gave rise to two great daughter families, M and N, which, in turn, became the mothers of billions. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Peter A Underhill. PLoS Biol 2010; 8: e1000536. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). Correspondence to G-M377, now also known as G2b1, has previously been designated G2b and G2c. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Haplogroup G-M201 | Familypedia | Fandom Sengupta S, Zhivotovsky LA, King R et al. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Slider with three articles shown per slide. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. Amongst the Madjars, G1 was found at a rate of 87%. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). Capelli C, Brisighelli F, Scarnicci F et al. ISSN 1476-5438 (online) [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. The authors declare no conflict of interest. Almost all L141 men belong to L141 subclades. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. PLoS One 2011; 6: e17548. It is provided at the request of readers. Haplogroup - an overview | ScienceDirect Topics Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. In the meantime, to ensure continued support, we are displaying the site without styles Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. King RJ, DiCristofaro J, Kouvatsi A et al. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Nasidze I, Quinque D, Dupanloup I et al. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Genomics 1999; 57: 433437. Please help update this article to reflect recent events or newly available information. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. Nature 2010; 466: 238242. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. CAS You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Am J Hum Genet 2004; 74: 5061. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. The genome-wide structure of the Jewish people. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Am J Hum Genet 2008; 82: 236250. Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. Members of this group have been found in Europe and the Middle East.[3]. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Origins and history of European Y-DNA and mtDNA haplogroups Artefactual values below 0% values were not depicted. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. Iceman tzi, known to have been a haplogr. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). Neolithic mitochondrial haplogroup H genomes and the genetic - Nature Eur J Hum Genet 2007; 15: 485493. P15 was identified at the University of Arizona and became widely known by 2002. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. It is not found among Native Americans except where intermarriage with non-native persons has occurred. Genome Res 2008; 18: 830838. Mol Biol Evol 2011; 28: 29052920. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. In other words, these mutations are so unique that they could only come from other cells with the same mutations. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The formula for the coalescence calculations is as follows: Age=25/1000 ASD0/0.00069. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations.
Desolation Gabriela Mistral Analysis,
List Of Approved Foreign Halal Certification Bodies Muis,
How To Get A Reservation At Nobu Malibu,
Articles H